Archivos por Etiqueta: ADN

Mitos falsos sobre el ADN. Todo lo que tienes que saber del ADN curiosidades

MITOS SOBRE EL ADN

No todo lo que pensabamos o nos han enseñado acerca del ADN es cierto. Por ello, vamos a ver una compilación de los mitos más conocidos de la mano del usuario de Twitter @paleofreak.

1. En el ADN no está “todo lo que somos”. Lo que “somos” surge de una interacción entre la información genética, la información no genética y también el azar.

2. El ADN no se autorreplica. Como molécula no tiene esa capacidad. Se necesita una complicada maquinaria y la participación de muchas otras moléculas. El ADN es replicado.

3. El ADN no dirige la célula. Es una molécula bastante inerte y pasiva; prácticamente no hace nada. Miles de proteínas interactúan con el ADN, extraen su información y la utilizan.

4. No es cierto que el ADN tenga millones de funciones desconocidas. La mayor parte de nuestro genoma no tiene función y consta de “ADN basura” (más info en CulturaCientífica).

5. Mi ADN y tu ADN y el ADN de un pino no se diferencian en el “código genético”. El código genético es el mismo (se confunde con genoma y con información genética). Lo puedes ampliar leyendo un poco en Wikipedia.

6. La información contenida en el ADN no tiene un origen misterioso o desconocido. Se va “grabando” durante el proceso evolutivo gracias a la selección natural, la deriva, la mutación, etc. Lo explica la teoría evolutiva.

Si te sigue interesando:

Dogma Central de la Biología (Lamb's Mother)

***

Introducción
Desde hacía tiempo se había observado una gran cantidad de ARN en todas las células que fabricaban muchas proteínas, lo que hacía pensar que las cadenas de ARN podrían servir de molde que especificara el orden de los aminoácidos en las proteínas. Efectivamente era así, el ARN era el intermediario entre el ADN y la proteína.
Todos estos avances parecían indicar que el flujo de la información biológica tenía direcciones permitidas (ADN » ARN » Proteína) y prohibidas todas las demás. Lo que llevó a Francis Crick a hipotetizar en 1958 y finalmente aprobarlo en 1970, su famoso dogma central de la biología molecular, que establece los flujos permitidos de la información hereditaria, la cual se almacena en el ADN y se utiliza para sintetizar las proteínas y no al reves. Esta regla se cumple tanto en células eurariotas como en bacterias.
Cómo se replica el ADN
El ADN se replica a sí mismo en el proceso llamado replicación, donde el ADN lleva la información. La fabricación o el paso de copiar el ADN al ARN se llama transcripción, donde esta sale al citoplasma, y la traducción, donde es leída por los ribosomas. Este ciclo se repite continuamente. Ahora vamos a explicarlo sobre la imagen: primero el ADN se replica (paso 1), más tarde pasa su información al ARN (paso 2) y, finalmente, esta información sale al citoplasma para ser leída por los ribosomas (paso 3). Cuando todo esto termina, el ADN vuelve a replicarse (paso 1), y así este ciclo sucesivo.
El mensaje que porta
El mensaje del ARN reside en la secuencia de los cuatro nucleótidos que se combinan para formar las grandes cadenas que forman. Existen cuatro bases: G = Guanina, C = Citosina, A = AdeninaT = Timina. Como ya sabemos, cada base se une con otra y no pueden mezclarse entre sí, así pues, la Adenina sólo puede unirse a la Timina (A=T) y la Citosina sólo puede unirse a la Guanina (C=G).
Los genes almacenados en el ADN
Un gen no es más que un trozo de ADN con una secuencia de esas cuatro letras, por ejemplo: AGGATGTATAGTGACTACTCG, si el gen de esas cuatro letras sufre algún cambio por cualquier causa (mutación) las consecuencias pueden ser:

  • Neutras: si este cambio no implica consecuencias significativas.
  • Perjudiciales: a consecuencia de esto la proteína es defectuosa y no cumple bien sus funciones, llegando incluso a ser mortal.
  • Beneficiosas: a veces una mutación en la secuencia hace que un individuo adquiera una ventaja frente a los individuos que no la tienen. Esto es fundamental para la evolución, ya que la selección natural actúa defendiendo a los mejor dotados frente a los peor dotados.

¿QUIERES VER MÁS DE CIENCIAS? Encuentra todo lo que buscas…

Transgénicos. Cultivos y alimentos transgénicos

***

El poder o habilidad de introducir en las semillas trozos de ADN de fuera (exógeno) tiene ventajas e inconvenientes. Actualmente tiene más ventajas que inconvenientes, pero a largo plazo se teme que los inconvenientes sean irremediables.
Ventajas de los transgénicos
Podemos obtener semillas que den lugar a plantas con características muy favorables, por ejemplo: que necesiten menos cantidad de agua para crecer, que tengan un periodo de cultivo más corto que el natural, que sean resistentes a plagas conocidas por la zona en la que se cultive, que fabriquen su propio insecticida y combata contra los pequeños organismos, que produzcan más y mejores frutos… En definitiva, que aumenten notablemente el rendimiento de los cultivos.
Inconvenientes de los transgénicos
En primer lugar, aunque no está demostrado, existen algunos científicos que piensan que podría haber efectos para la salud a largo plazo. Analizando a corto plazo todavía no han detectado ninguna anomalía, pero algunos investigan sobre los efectos a largo plazo.
En segundo lugar, se están produciendo numerosos casos de hibridación entre plantas transgénicas y plantas silvestres (no transgénicas). Esta hibridación consiste en que donde hay un cultivo transgénico, los insectos y el viento transportan el polen hasta plantas de la misma especie pero silvestres (naturales), produciéndose así en la planta silvestre un apareamiento que conlleva a transformar la planta silvestre en una mezcla entre lo natural y lo transgénico. De esta forma podría ocurrir, siempre hablando de un largo plazo, a la extinción silvestre de esa especie de planta.
Para entender este último párrafo, he decidido hacer un dibujo explicativo:

¿QUIERES VER MÁS DE CIENCIAS? Encuentra todo lo que buscas…