Archivos de Categoría: Ciencia y Filosofía

Desviar la trayectoria de un asteroide (Yarkovsky)

***

La NASA investiga la posibilidad de desviar la trayectoria de un asteroide. La idea es dirigirse al asteroide en una nave espacial y verter sobre él un líquido especial (una especie de pintura) que permita absorber o focalizar mayor cantidad de radiación en esa parte. De esta forma, se podría modificar la trayectoria del asteroide (efecto Yarkovsky)
Esto fue descubierto en 1900 por un ingeniero ruso llamado Ivan Osipovich Yarkovsky, que observó lo que la incidencia del Sol en un cuerpo puede modificar su órbita, es decir, la radiación en una cara determinada de un asteroide lo desestabiliza y modifica su trayectoria.
Aunque todo esto puede sonar fantasioso, la tecnología y el incremento de saberes puede servirnos para la vida real, como en el caso del asteroide 29075 1950 DA (dimensiones aproximadas: ~1,3 km), que se estima un cruce con la trayectoria de la Tierra en el año 2880.

¿QUIERES VER MÁS DE CIENCIAS? Mira más artículos aquí…

Dogma Central de la Biología (Lamb's Mother)

***

Introducción
Desde hacía tiempo se había observado una gran cantidad de ARN en todas las células que fabricaban muchas proteínas, lo que hacía pensar que las cadenas de ARN podrían servir de molde que especificara el orden de los aminoácidos en las proteínas. Efectivamente era así, el ARN era el intermediario entre el ADN y la proteína.
Todos estos avances parecían indicar que el flujo de la información biológica tenía direcciones permitidas (ADN » ARN » Proteína) y prohibidas todas las demás. Lo que llevó a Francis Crick a hipotetizar en 1958 y finalmente aprobarlo en 1970, su famoso dogma central de la biología molecular, que establece los flujos permitidos de la información hereditaria, la cual se almacena en el ADN y se utiliza para sintetizar las proteínas y no al reves. Esta regla se cumple tanto en células eurariotas como en bacterias.
Cómo se replica el ADN
El ADN se replica a sí mismo en el proceso llamado replicación, donde el ADN lleva la información. La fabricación o el paso de copiar el ADN al ARN se llama transcripción, donde esta sale al citoplasma, y la traducción, donde es leída por los ribosomas. Este ciclo se repite continuamente. Ahora vamos a explicarlo sobre la imagen: primero el ADN se replica (paso 1), más tarde pasa su información al ARN (paso 2) y, finalmente, esta información sale al citoplasma para ser leída por los ribosomas (paso 3). Cuando todo esto termina, el ADN vuelve a replicarse (paso 1), y así este ciclo sucesivo.
El mensaje que porta
El mensaje del ARN reside en la secuencia de los cuatro nucleótidos que se combinan para formar las grandes cadenas que forman. Existen cuatro bases: G = Guanina, C = Citosina, A = AdeninaT = Timina. Como ya sabemos, cada base se une con otra y no pueden mezclarse entre sí, así pues, la Adenina sólo puede unirse a la Timina (A=T) y la Citosina sólo puede unirse a la Guanina (C=G).
Los genes almacenados en el ADN
Un gen no es más que un trozo de ADN con una secuencia de esas cuatro letras, por ejemplo: AGGATGTATAGTGACTACTCG, si el gen de esas cuatro letras sufre algún cambio por cualquier causa (mutación) las consecuencias pueden ser:

  • Neutras: si este cambio no implica consecuencias significativas.
  • Perjudiciales: a consecuencia de esto la proteína es defectuosa y no cumple bien sus funciones, llegando incluso a ser mortal.
  • Beneficiosas: a veces una mutación en la secuencia hace que un individuo adquiera una ventaja frente a los individuos que no la tienen. Esto es fundamental para la evolución, ya que la selección natural actúa defendiendo a los mejor dotados frente a los peor dotados.

¿QUIERES VER MÁS DE CIENCIAS? Encuentra todo lo que buscas…

La reproducción, el genotipo y el fenotipo

***

Los Cromosomas
Como vemos en la imagen, los cromosomas humanos están ordenados de mayor a menor (del 1 al 23) y podemos observar el último par de cromosomas que está formado por los cromosomas sexuales: el cromosoma X y el cromosoma Y. Uno de estos dos permitirá que en la fecundación, el cigoto reproduzca información para crear un varón (si sale el cromosoma Y) o que reproduzca información para crear a una hembra (cromosoma X). Existen las mismas posibilidades de que salga varón o hembra.
Las células adultas de nuestro organismo (células somáticas) poseen los cromosomas organizados por pares. En concreto poseen 23 pares de cromosomas. Estas células son diploides, y se representan «2n».
Las células sexuales o reproductoras, sólo poseen de cada par un cromosoma, es decir, sólo tienen 23 cromosomas; y este grupo comprende los gametos (óvulos y espermatozoides), que se llaman células haploides y se representa «n».
Genotipo y Fenotipo
El genotipo de un individuo es el conjunto de genes que posee heredados de sus antepasados, pero que no se manifiesta en esa generación determinada.
El fenotipo es lo que se ve, las manifestaciones de esos genes. Sucede con alguna frecuencia que algunos genes que un individuo posee, no se manifiesta. Este individuo recibe el nombre de portador.
Aunque un gen no se manifieste, si un individuo lo aporta, lo puede transmitir a sus hijos. Por lo cual es posible que un individuo tenga un hijo que manifieste un caracter que ninguno de los dos padres tenía, pero que sí eran portadores de ese caracter. También se han dado casos donde los hijos han tenido caracteres de sus bisabuelos o tatarabuelos, gracias a que sus padres y abuelos eran portadores de dicho gen.

¿QUIERES VER MÁS DE CIENCIAS? Encuentra todo lo que buscas…

Transgénicos. Cultivos y alimentos transgénicos

***

El poder o habilidad de introducir en las semillas trozos de ADN de fuera (exógeno) tiene ventajas e inconvenientes. Actualmente tiene más ventajas que inconvenientes, pero a largo plazo se teme que los inconvenientes sean irremediables.
Ventajas de los transgénicos
Podemos obtener semillas que den lugar a plantas con características muy favorables, por ejemplo: que necesiten menos cantidad de agua para crecer, que tengan un periodo de cultivo más corto que el natural, que sean resistentes a plagas conocidas por la zona en la que se cultive, que fabriquen su propio insecticida y combata contra los pequeños organismos, que produzcan más y mejores frutos… En definitiva, que aumenten notablemente el rendimiento de los cultivos.
Inconvenientes de los transgénicos
En primer lugar, aunque no está demostrado, existen algunos científicos que piensan que podría haber efectos para la salud a largo plazo. Analizando a corto plazo todavía no han detectado ninguna anomalía, pero algunos investigan sobre los efectos a largo plazo.
En segundo lugar, se están produciendo numerosos casos de hibridación entre plantas transgénicas y plantas silvestres (no transgénicas). Esta hibridación consiste en que donde hay un cultivo transgénico, los insectos y el viento transportan el polen hasta plantas de la misma especie pero silvestres (naturales), produciéndose así en la planta silvestre un apareamiento que conlleva a transformar la planta silvestre en una mezcla entre lo natural y lo transgénico. De esta forma podría ocurrir, siempre hablando de un largo plazo, a la extinción silvestre de esa especie de planta.
Para entender este último párrafo, he decidido hacer un dibujo explicativo:

¿QUIERES VER MÁS DE CIENCIAS? Encuentra todo lo que buscas…